Construct: ORF TRCN0000477425
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008872.1_s317c1
- Derived from:
- ccsbBroadEn_07949
- DNA Barcode:
- GGGGGGGACAGCACGACATCACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MGAT4C (25834)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477425
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351285.2 | 99.9% | 99.7% | 1283C>G |
2 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351286.2 | 99.9% | 99.7% | 1283C>G |
3 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351287.2 | 99.9% | 99.7% | 1283C>G |
4 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351288.2 | 99.9% | 99.7% | 1283C>G |
5 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351289.2 | 99.9% | 99.7% | 1283C>G |
6 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351291.2 | 99.9% | 99.7% | 1283C>G |
7 | human | 25834 | MGAT4C | MGAT4 family member C | NM_013244.5 | 99.9% | 99.7% | 1283C>G |
8 | human | 25834 | MGAT4C | MGAT4 family member C | XM_024448932.1 | 99.3% | 99.1% | 1_9delATGAAGAGA;1292C>G |
9 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351283.2 | 94.2% | 94% | 1_87del;1370C>G |
10 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351284.2 | 94.2% | 94% | 1_87del;1370C>G |
11 | human | 25834 | MGAT4C | MGAT4 family member C | XM_017019146.2 | 94.2% | 94% | 1_87del;1370C>G |
12 | human | 25834 | MGAT4C | MGAT4 family member C | NM_001351282.2 | 92.5% | 92.4% | 1_114del;1397C>G |
13 | human | 25834 | MGAT4C | MGAT4 family member C | XM_011538151.3 | 92.5% | 92.4% | 1_114del;1397C>G |
14 | human | 25834 | MGAT4C | MGAT4 family member C | XM_017019144.2 | 92.5% | 92.4% | 1_114del;1397C>G |
15 | human | 25834 | MGAT4C | MGAT4 family member C | XM_024448931.1 | 92.5% | 92.4% | 1_114del;1397C>G |
16 | human | 25834 | MGAT4C | MGAT4 family member C | XM_017019143.2 | 90.6% | 90.5% | 1_147del;1430C>G |
17 | human | 25834 | MGAT4C | MGAT4 family member C | XM_024448930.1 | 86.5% | 86.4% | 1_222del;1505C>G |
18 | human | 25834 | MGAT4C | MGAT4 family member C | NR_147093.2 | 10.4% | (many diffs) | |
19 | mouse | 67569 | Mgat4c | MGAT4 family, member C | NM_001162368.1 | 88.9% | 94.5% | (many diffs) |
20 | mouse | 67569 | Mgat4c | MGAT4 family, member C | NM_001162369.1 | 88.9% | 94.5% | (many diffs) |
21 | mouse | 67569 | Mgat4c | MGAT4 family, member C | NM_001205098.1 | 88.9% | 94.5% | (many diffs) |
22 | mouse | 67569 | Mgat4c | MGAT4 family, member C | NM_026243.4 | 88.9% | 94.5% | (many diffs) |
23 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_006514002.1 | 88.9% | 94.5% | (many diffs) |
24 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_006514003.1 | 88.9% | 94.5% | (many diffs) |
25 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_006514004.3 | 88.9% | 94.5% | (many diffs) |
26 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_006514005.2 | 88.9% | 94.5% | (many diffs) |
27 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_011243538.2 | 88.9% | 94.5% | (many diffs) |
28 | mouse | 67569 | Mgat4c | MGAT4 family, member C | XM_011243539.1 | 88.9% | 94.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1503
- ORF length:
- 1434
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtttaaattt catcaaatga aacatatttt tgaaatactt gataaaatga 121 gatgcctgag aaaacgttct acagtgtcat tcttgggagt tcttgtcatt tttctccttt 181 ttatgaactt gtacattgaa gatagctatg ttctggaagg agacaaacaa cttataaggg 241 aaacatccac acatcaactg aattcagaac gctatgttca tactttcaag gatttatcta 301 atttctcagg agccataaat gtcacctatc gctacctagc tgccacacct ttacaaagaa 361 agcggtatct tacaattgga ctttcttcag taaagcgaaa aaaaggaaac tatttacttg 421 agacaattaa gtcaattttt gagcaatcca gctatgaaga gctgaaggaa atttcagtgg 481 tggttcacct agcagacttt aattcttcct ggcgtgatgc catggtccag gatattacac 541 agaaatttgc gcaccatatt attgcaggaa gattaatggt tatacatgct ccagaggagt 601 attacccaat cctagatggc cttaaaagaa attacaatga tccagaagat agagtcaaat 661 ttcgttccaa gcaaaatgta gattatgctt ttctgcttaa tttttgtgcc aatacttcag 721 actattatgt aatgcttgaa gatgatgttc gatgttcaaa aaatttctta actgccatca 781 agaaagtcat tgcatcccta gaaggaactt actgggtaac tcttgaattc tctaagcttg 841 gctacattgg taaactctat cattctcatg atctcccacg tttggcccat tttttattaa 901 tgttttatca agaaatgcct tgtgattggc tattgactca tttccgtggt ctgttggctc 961 agaaaaatgt gatccgtttt aaaccatctc tctttcagca catgggctat tattcatcat 1021 acaaagggac ggagaataag ctgaaggatg atgattttga agaggagtca tttgacattc 1081 ctgataaccc ccctgcaagt ctgtacacca acatgaatgt gtttgaaaat tatgaagcaa 1141 gcaaggctta cagtagtgtt gatgagtact tttgggggaa acCACCTTCA ACAGGAGATG 1201 TTTTTGTGAT TGTATTTGAA AATCCAATTA TAATAAAAAA AATTAAAGTA AATACTGGAA 1261 CAGAAGATCG GCAAAATGAT ATTTTGCATC ATGGAGCCCT AGATGTTGGG GAAAACGTTA 1321 TGCCTAGCAA ACAAAGGAGA CAATGTTCTA GTTACTTAAG ACTAGGAGAA TTCAAAAATG 1381 GAAACTTTGA AATGTCAGGT GTAAATCAAA AAATTCCATT TGATATACAT TGTATGAGGA 1441 TATATGTCAC CAAAACACAA AAGGAATGGC TAATTATTAG GAGTATTAGC ATTTGGACTT 1501 CTTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1561 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1621 GGCTTTATAT ATCTTGTGGA AAGGACGAGG GGGGGACAGC ACGACATCAC TGACGCGTTA 1681 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt