Transcript: Mouse XR_385265.3

PREDICTED: Mus musculus anaplastic lymphoma kinase (Alk), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Alk (11682)
Length:
3879
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385265.3
NBCI Gene record:
Alk (11682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023451 CCGTGGGATTTGACAACATTT pLKO.1 2816 3UTR 100% 13.200 18.480 N Gm1913 n/a
2 TRCN0000361003 GTGGAGCCACCTACGTGTTTA pLKO_005 3416 3UTR 100% 13.200 18.480 N Alk n/a
3 TRCN0000023453 CCCTGAATTCAGTACCCAAAT pLKO.1 2885 3UTR 100% 0.000 0.000 N Gm1913 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14540 pDONR223 0% 43.2% None (many diffs) n/a
2 ccsbBroad304_14540 pLX_304 0% 43.2% V5 (many diffs) n/a
3 TRCN0000469859 GAGCGTGGTCCCCGGCAGTTAAGG pLX_317 8.4% 43.2% V5 (many diffs) n/a
Download CSV