Transcript: Mouse XM_006519897.3

PREDICTED: Mus musculus predicted gene, 21451 (Gm21451), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm21451 (100862072)
Length:
2458
CDS:
266..2443

Additional Resources:

NCBI RefSeq record:
XM_006519897.3
NBCI Gene record:
Gm21451 (100862072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076711 CCAAATAGAGAGCCTAAATAT pLKO.1 796 CDS 100% 15.000 7.500 Y Loxl2 n/a
2 TRCN0000076712 CAACCAAATAGAGAGCCTAAA pLKO.1 793 CDS 100% 10.800 5.400 Y Loxl2 n/a
3 TRCN0000076710 CCTGGTGCTTAATGCTGAGAT pLKO.1 1939 CDS 100% 4.950 2.475 Y Loxl2 n/a
4 TRCN0000076709 GCATGGAAATATCTTCGCCAA pLKO.1 1780 CDS 100% 2.160 1.080 Y Loxl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489515 TGGACACTCACAATCAATGCAGAT pLX_317 12.7% 77.2% 78.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488025 TTGTTCGGACCCTTCATACATCTA pLX_317 13.1% 77.1% 78.4% V5 (many diffs) n/a
Download CSV