Transcript: Mouse XM_017322048.1

PREDICTED: Mus musculus ubiquitin-conjugating enzyme E2W (putative) (Ube2w), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube2w (66799)
Length:
5742
CDS:
78..455

Additional Resources:

NCBI RefSeq record:
XM_017322048.1
NBCI Gene record:
Ube2w (66799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241023 GCCGGCAATGGACGTTGTAAA pLKO_005 813 3UTR 100% 13.200 10.560 N Ube2w n/a
2 TRCN0000241027 GGTGCACCAGGAACCTTATAT pLKO_005 291 CDS 100% 15.000 10.500 N Ube2w n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03571 pDONR223 100% 49.8% 43.9% None (many diffs) n/a
2 ccsbBroad304_03571 pLX_304 0% 49.8% 43.9% V5 (many diffs) n/a
3 TRCN0000474929 CCATCCTTACCAGAAACAACTCCC pLX_317 100% 49.8% 43.9% V5 (many diffs) n/a
4 ccsbBroadEn_12198 pDONR223 100% 47.1% 40.5% None (many diffs) n/a
5 ccsbBroad304_12198 pLX_304 0% 47.1% 40.5% V5 (many diffs) n/a
6 TRCN0000472955 AACAAGGGTAGCCGCACGAGGCGT pLX_317 90.5% 47.1% 40.5% V5 (many diffs) n/a
Download CSV