Transcript: Mouse XM_017314894.1

PREDICTED: Mus musculus chimerin 1 (Chn1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chn1 (108699)
Length:
1038
CDS:
3..920

Additional Resources:

NCBI RefSeq record:
XM_017314894.1
NBCI Gene record:
Chn1 (108699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047801 GCTTTAAGATTTGGAAGTCAA pLKO.1 579 CDS 100% 4.950 3.960 N CHN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00303 pDONR223 100% 31.8% 30.4% None (many diffs) n/a
2 ccsbBroad304_00303 pLX_304 0% 31.8% 30.4% V5 (many diffs) n/a
3 TRCN0000474759 TCATCAGAACGTTGCGGATCAGGG pLX_317 21.9% 31.8% 30.4% V5 (many diffs) n/a
Download CSV