Transcript: Mouse XM_006527939.2

PREDICTED: Mus musculus transducin (beta)-like 1 X-linked (Tbl1x), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbl1x (21372)
Length:
5496
CDS:
941..2524

Additional Resources:

NCBI RefSeq record:
XM_006527939.2
NBCI Gene record:
Tbl1x (21372)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109357 CCGAACTCCAACATCATGTTA pLKO.1 2204 CDS 100% 5.625 7.875 N Tbl1x n/a
2 TRCN0000317500 CCGAACTCCAACATCATGTTA pLKO_005 2204 CDS 100% 5.625 7.875 N Tbl1x n/a
3 TRCN0000109358 CCTTCACGTTTGGGATCGAAA pLKO.1 1014 CDS 100% 4.950 6.930 N Tbl1x n/a
4 TRCN0000109356 GCGAGGATATGGAACCTTAAT pLKO.1 1556 CDS 100% 13.200 10.560 N Tbl1x n/a
5 TRCN0000317575 GCGAGGATATGGAACCTTAAT pLKO_005 1556 CDS 100% 13.200 10.560 N Tbl1x n/a
6 TRCN0000109359 GACATGATGTTCCCAGTAATA pLKO.1 1635 CDS 100% 13.200 9.240 N Tbl1x n/a
7 TRCN0000317499 GACATGATGTTCCCAGTAATA pLKO_005 1635 CDS 100% 13.200 9.240 N Tbl1x n/a
8 TRCN0000109355 GCATGGTTGTATCACAGGAAT pLKO.1 2733 3UTR 100% 4.950 3.465 N Tbl1x n/a
9 TRCN0000317501 GCATGGTTGTATCACAGGAAT pLKO_005 2733 3UTR 100% 4.950 3.465 N Tbl1x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04526 pDONR223 100% 85.6% 92.9% None (many diffs) n/a
2 ccsbBroad304_04526 pLX_304 0% 85.6% 92.9% V5 (many diffs) n/a
3 TRCN0000466084 ACACCCCAAGATTCCCCTAAGATG pLX_317 20.9% 85.6% 92.9% V5 (many diffs) n/a
Download CSV