Transcript: Mouse XM_017313242.1

PREDICTED: Mus musculus RNA binding motif, single stranded interacting protein (Rbms3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbms3 (207181)
Length:
2691
CDS:
226..2691

Additional Resources:

NCBI RefSeq record:
XM_017313242.1
NBCI Gene record:
Rbms3 (207181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096893 CCTACGAATCTATACATCTCA pLKO.1 1846 CDS 100% 3.000 4.200 N Rbms3 n/a
2 TRCN0000096891 GCAAGACCCTACGAATCTATA pLKO.1 1839 CDS 100% 13.200 9.240 N Rbms3 n/a
3 TRCN0000096890 GCTGTTTCTATTGAAGGTGTT pLKO.1 2545 CDS 100% 4.050 2.430 N Rbms3 n/a
4 TRCN0000151605 GCTGTTTCTATTGAAGGTGTT pLKO.1 2545 CDS 100% 4.050 2.430 N RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11862 pDONR223 100% 26.9% 27.7% None (many diffs) n/a
2 ccsbBroad304_11862 pLX_304 0% 26.9% 27.7% V5 (many diffs) n/a
3 TRCN0000469899 GCTCCCGTCAAATCGATTTGTAGC pLX_317 61.1% 26.9% 27.7% V5 (many diffs) n/a
Download CSV