Transcript: Mouse XM_006516793.3

PREDICTED: Mus musculus solute carrier family 22, member 23 (Slc22a23), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc22a23 (73102)
Length:
5357
CDS:
1..2046

Additional Resources:

NCBI RefSeq record:
XM_006516793.3
NBCI Gene record:
Slc22a23 (73102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252939 ATGCTGACAGCGCCCATTATT pLKO_005 1732 CDS 100% 15.000 21.000 N Slc22a23 n/a
2 TRCN0000252940 TAATCTTTGGCTACCTAATAA pLKO_005 704 CDS 100% 15.000 21.000 N Slc22a23 n/a
3 TRCN0000252941 CTCAACTTGATCGGCAAATAC pLKO_005 1525 CDS 100% 13.200 18.480 N Slc22a23 n/a
4 TRCN0000267479 CCTGTTCACAGCACAAGTTTA pLKO_005 5223 3UTR 100% 13.200 9.240 N Slc22a23 n/a
5 TRCN0000252938 GGCTACTTCCTGCACCATATC pLKO_005 1771 CDS 100% 10.800 7.560 N Slc22a23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15959 pDONR223 0% 52.9% 56.6% None (many diffs) n/a
2 ccsbBroad304_15959 pLX_304 0% 52.9% 56.6% V5 (many diffs) n/a
3 TRCN0000480955 TAGGGCTAGACCTGTCATTTAATA pLX_317 33% 52.9% 56.6% V5 (many diffs) n/a
4 ccsbBroadEn_08805 pDONR223 100% 52.9% 56.6% None (many diffs) n/a
5 ccsbBroad304_08805 pLX_304 0% 52.9% 56.6% V5 (many diffs) n/a
6 TRCN0000491827 CGCAGGAATATCAATACTACTTAA pLX_317 20.5% 52.9% 56.6% V5 (many diffs) n/a
Download CSV