Transcript: Mouse XM_017320486.1

PREDICTED: Mus musculus minichromosome maintenance domain containing 2 (Mcmdc2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcmdc2 (240697)
Length:
6985
CDS:
5563..6648

Additional Resources:

NCBI RefSeq record:
XM_017320486.1
NBCI Gene record:
Mcmdc2 (240697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264915 CTATCGGTTCAGTATTCTAAT pLKO_005 5679 CDS 100% 13.200 10.560 N Mcmdc2 n/a
2 TRCN0000264914 GAGAAGACTGCTTGGATATTT pLKO_005 6581 CDS 100% 15.000 10.500 N Mcmdc2 n/a
3 TRCN0000264913 CTTTGTGAGTTTCCACTTAAT pLKO_005 5905 CDS 100% 13.200 9.240 N Mcmdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 52.4% 51.6% None (many diffs) n/a
2 ccsbBroad304_13302 pLX_304 0% 52.4% 51.6% V5 (many diffs) n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 52.4% 51.6% V5 (many diffs) n/a
Download CSV