Transcript: Human NM_001330201.1

Homo sapiens eukaryotic translation initiation factor 4E family member 2 (EIF4E2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
EIF4E2 (9470)
Length:
935
CDS:
139..741

Additional Resources:

NCBI RefSeq record:
NM_001330201.1
NBCI Gene record:
EIF4E2 (9470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155036 GAATAAGACTGCCAGTGACCA pLKO.1 552 CDS 100% 2.640 2.112 N EIF4E2 n/a
2 TRCN0000280915 GAATAAGACTGCCAGTGACCA pLKO_005 552 CDS 100% 2.640 2.112 N EIF4E2 n/a
3 TRCN0000152131 CGCTTTCAGGAAGACATTATT pLKO.1 523 CDS 100% 15.000 10.500 N EIF4E2 n/a
4 TRCN0000297899 CGCTTTCAGGAAGACATTATT pLKO_005 523 CDS 100% 15.000 10.500 N EIF4E2 n/a
5 TRCN0000328360 CTACCTCCCAACACCATTATG pLKO_005 619 CDS 100% 13.200 9.240 N Eif4e2 n/a
6 TRCN0000328425 ATGTGGGAGGATGATGCAAAT pLKO_005 370 CDS 100% 10.800 7.560 N Eif4e2 n/a
7 TRCN0000200650 CAACACCATTATGGAATACAA pLKO.1 627 CDS 100% 5.625 3.938 N Eif4e2 n/a
8 TRCN0000153918 CACACAGAAAGATGGTGAGAA pLKO.1 207 CDS 100% 4.950 3.465 N EIF4E2 n/a
9 TRCN0000190163 CCTCCCAACACCATTATGGAA pLKO.1 622 CDS 100% 3.000 2.100 N Eif4e2 n/a
10 TRCN0000155802 CGGAACGAGACAAGAATCAGA pLKO.1 236 CDS 100% 3.000 2.100 N EIF4E2 n/a
11 TRCN0000280918 CGGAACGAGACAAGAATCAGA pLKO_005 236 CDS 100% 3.000 2.100 N EIF4E2 n/a
12 TRCN0000155974 CGAGACAAGAATCAGAGCAGT pLKO.1 241 CDS 100% 2.640 1.848 N EIF4E2 n/a
13 TRCN0000189894 GCACACAGAAAGATGGTGAGA pLKO.1 206 CDS 100% 2.640 1.848 N Eif4e2 n/a
14 TRCN0000152006 CCATCTCTTCAAAGAAGGAAT pLKO.1 342 CDS 100% 4.950 2.970 N EIF4E2 n/a
15 TRCN0000280916 CCATCTCTTCAAAGAAGGAAT pLKO_005 342 CDS 100% 4.950 2.970 N EIF4E2 n/a
16 TRCN0000151182 GACCATGATCAGAATGAAGAA pLKO.1 181 CDS 100% 4.950 2.970 N EIF4E2 n/a
17 TRCN0000280917 GACCATGATCAGAATGAAGAA pLKO_005 181 CDS 100% 4.950 2.970 N EIF4E2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07422 pDONR223 100% 81.3% 81.2% None 20C>G;135_136ins135;600A>G n/a
2 ccsbBroad304_07422 pLX_304 0% 81.3% 81.2% V5 20C>G;135_136ins135;600A>G n/a
3 TRCN0000474313 AGCAGAACTTCTATACATGGCCAT pLX_317 56.5% 81.3% 81.2% V5 20C>G;135_136ins135;600A>G n/a
4 ccsbBroadEn_11370 pDONR223 100% 78.1% 73.8% None 135_136ins135;562_563insT;600_601ins32 n/a
5 ccsbBroad304_11370 pLX_304 0% 78.1% 73.8% V5 135_136ins135;562_563insT;600_601ins32 n/a
6 TRCN0000475357 CCAAGGACAAAGTCTAGAGAGCCT pLX_317 58.2% 78.1% 73.8% V5 135_136ins135;562_563insT;600_601ins32 n/a
Download CSV