Transcript: Human NM_001330267.1

Homo sapiens grancalcin (GCA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GCA (25801)
Length:
3724
CDS:
161..859

Additional Resources:

NCBI RefSeq record:
NM_001330267.1
NBCI Gene record:
GCA (25801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054136 GCGAATTTCATATATGACGAT pLKO.1 812 CDS 100% 2.640 3.696 N GCA n/a
2 TRCN0000291531 GCGAATTTCATATATGACGAT pLKO_005 812 CDS 100% 2.640 3.696 N GCA n/a
3 TRCN0000054133 GCCAGCATATTCAGACACTTA pLKO.1 325 CDS 100% 4.950 3.960 N GCA n/a
4 TRCN0000291530 GCCAGCATATTCAGACACTTA pLKO_005 325 CDS 100% 4.950 3.960 N GCA n/a
5 TRCN0000054134 CCATTGGTCTTATGGGTTATA pLKO.1 645 CDS 100% 13.200 9.240 N GCA n/a
6 TRCN0000291582 CCATTGGTCTTATGGGTTATA pLKO_005 645 CDS 100% 13.200 9.240 N GCA n/a
7 TRCN0000054135 CGAGCATTGACAGATTTCTTT pLKO.1 761 CDS 100% 5.625 3.938 N GCA n/a
8 TRCN0000307717 CGAGCATTGACAGATTTCTTT pLKO_005 761 CDS 100% 5.625 3.938 N GCA n/a
9 TRCN0000054137 GTCTGGAATTAATGGAACTTA pLKO.1 442 CDS 100% 5.625 3.938 N GCA n/a
10 TRCN0000291585 GTCTGGAATTAATGGAACTTA pLKO_005 442 CDS 100% 5.625 3.938 N GCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07945 pDONR223 100% 91.9% 89.6% None (many diffs) n/a
2 ccsbBroad304_07945 pLX_304 0% 91.9% 89.6% V5 (many diffs) n/a
3 TRCN0000471038 CGAAAGGACCTTGTTAACAGTTTA pLX_317 77.1% 91.9% 89.6% V5 (many diffs) n/a
Download CSV