Transcript: Mouse NM_001348087.1

Mus musculus uridine monophosphate synthetase (Umps), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Umps (22247)
Length:
3330
CDS:
438..1349

Additional Resources:

NCBI RefSeq record:
NM_001348087.1
NBCI Gene record:
Umps (22247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075896 CGCGGTTCTGATGTCATCATT pLKO.1 1227 CDS 100% 5.625 7.875 N Umps n/a
2 TRCN0000075894 GCCTTGTAGAAGGAGAGATTA pLKO.1 223 5UTR 100% 13.200 9.240 N Umps n/a
3 TRCN0000075895 CCTGAGAAGAAAGCGTGCAAA pLKO.1 552 CDS 100% 4.950 3.465 N Umps n/a
4 TRCN0000075893 GCACCCACATTGTGTCTCAAA pLKO.1 1872 3UTR 100% 4.950 3.465 N Umps n/a
5 TRCN0000075897 GCAGTATGAAAGTGGCACCTT pLKO.1 875 CDS 100% 2.640 1.848 N Umps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01755 pDONR223 100% 52.4% 55% None (many diffs) n/a
2 ccsbBroad304_01755 pLX_304 0% 52.4% 55% V5 (many diffs) n/a
3 TRCN0000466150 GTAATATAACCAAGGGGTTTTTTC pLX_317 25.3% 52.4% 55% V5 (many diffs) n/a
4 TRCN0000489048 CATGCCGGTCACCAGTGATATTTG pLX_317 25.8% 52.4% 55% V5 (many diffs) n/a
5 TRCN0000489354 GGCCCGAACCACCTAATGTGCATA pLX_317 27.2% 52.3% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV