Transcript: Mouse NM_001347453.1

Mus musculus VPS29 retromer complex component (Vps29), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Vps29 (56433)
Length:
2723
CDS:
106..666

Additional Resources:

NCBI RefSeq record:
NM_001347453.1
NBCI Gene record:
Vps29 (56433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295311 GCTGGTCTCCACCACTTATTT pLKO_005 673 3UTR 100% 15.000 21.000 N Vps29 n/a
2 TRCN0000295312 GTAGAACGAATTGAGTATAAA pLKO_005 637 CDS 100% 15.000 21.000 N Vps29 n/a
3 TRCN0000111587 CCAGTTCAAGATCGGTCTGAT pLKO.1 351 CDS 100% 4.950 6.930 N Vps29 n/a
4 TRCN0000111585 CGTTAGGAAGTTGTCCTTGTA pLKO.1 894 3UTR 100% 4.950 6.930 N Vps29 n/a
5 TRCN0000111586 GCCTTGGAAACAAACATTATT pLKO.1 538 CDS 100% 15.000 10.500 N Vps29 n/a
6 TRCN0000287955 GCCTTGGAAACAAACATTATT pLKO_005 538 CDS 100% 15.000 10.500 N Vps29 n/a
7 TRCN0000381934 ATCCACGGACACCAAGTTATT pLKO_005 370 CDS 100% 13.200 9.240 N Vps29 n/a
8 TRCN0000307514 CCAAGGAGAGCTACGACTATC pLKO_005 242 CDS 100% 10.800 7.560 N Vps29 n/a
9 TRCN0000379753 TAATCCATAGTTGCTCTAAAG pLKO_005 791 3UTR 100% 10.800 7.560 N Vps29 n/a
10 TRCN0000111589 GTGGTCACTTACGTCTATCAA pLKO.1 595 CDS 100% 5.625 3.938 N Vps29 n/a
11 TRCN0000287881 GTGGTCACTTACGTCTATCAA pLKO_005 595 CDS 100% 5.625 3.938 N Vps29 n/a
12 TRCN0000111588 GTCACTTACGTCTATCAACTA pLKO.1 598 CDS 100% 4.950 3.465 N Vps29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03366 pDONR223 100% 90.1% 99.4% None (many diffs) n/a
2 ccsbBroad304_03366 pLX_304 0% 90.1% 99.4% V5 (many diffs) n/a
3 TRCN0000481468 CTACGTAAACCGGCCGTCGTGACC pLX_317 79.4% 90.1% 99.4% V5 (many diffs) n/a
Download CSV