Transcript: Human NM_001352813.1

Homo sapiens zinc finger protein 385B (ZNF385B), transcript variant 11, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
ZNF385B (151126)
Length:
2645
CDS:
256..1365

Additional Resources:

NCBI RefSeq record:
NM_001352813.1
NBCI Gene record:
ZNF385B (151126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116204 GCGGTTATTAACCATACATTT pLKO.1 364 CDS 100% 13.200 18.480 N ZNF385B n/a
2 TRCN0000116203 CCCGAGTATTCTAGCAGCAAA pLKO.1 1131 CDS 100% 4.950 6.930 N ZNF385B n/a
3 TRCN0000116205 GCTGGTCCAATTAAATCCTAT pLKO.1 904 CDS 100% 4.950 6.930 N ZNF385B n/a
4 TRCN0000116206 GCCCACTACAAAGGAAGTAAA pLKO.1 469 CDS 100% 13.200 9.240 N ZNF385B n/a
5 TRCN0000116202 CCAGAGAGAAACACATCACTA pLKO.1 1504 3UTR 100% 4.950 2.970 N ZNF385B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09677 pDONR223 100% 99.8% 99.4% None 9G>T;430C>A n/a
2 ccsbBroad304_09677 pLX_304 0% 99.8% 99.4% V5 9G>T;430C>A n/a
3 TRCN0000470628 CATTGACGATGAAGAGCCGTGGAA pLX_317 40.3% 99.8% 99.4% V5 9G>T;430C>A n/a
Download CSV