Transcript: Human NM_017444.6

Homo sapiens chromatin accessibility complex subunit 1 (CHRAC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CHRAC1 (54108)
Length:
2481
CDS:
179..574

Additional Resources:

NCBI RefSeq record:
NM_017444.6
NBCI Gene record:
CHRAC1 (54108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017444.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274444 GTGGTATTCTTTCGAGGTATT pLKO_005 694 3UTR 100% 10.800 15.120 N CHRAC1 n/a
2 TRCN0000381032 TCAATGCCTAGCCACCTATTC pLKO_005 337 CDS 100% 10.800 15.120 N CHRAC1 n/a
3 TRCN0000017399 TGACTTACAGTGATTTAGCAA pLKO.1 393 CDS 100% 3.000 4.200 N CHRAC1 n/a
4 TRCN0000380232 ACTCCACTGTCTCTAAGTAAA pLKO_005 622 3UTR 100% 13.200 9.240 N CHRAC1 n/a
5 TRCN0000017401 ACACTGCACAGCAATCAGAAA pLKO.1 414 CDS 100% 4.950 3.465 N CHRAC1 n/a
6 TRCN0000285211 ACACTGCACAGCAATCAGAAA pLKO_005 414 CDS 100% 4.950 3.465 N CHRAC1 n/a
7 TRCN0000274394 TTAGCTAGTAAATACCTGAAA pLKO_005 473 CDS 100% 4.950 3.465 N CHRAC1 n/a
8 TRCN0000017402 GAAAGTGACCATGATGAAGCT pLKO.1 545 CDS 100% 2.640 1.848 N CHRAC1 n/a
9 TRCN0000274443 GAAAGTGACCATGATGAAGCT pLKO_005 545 CDS 100% 2.640 1.848 N CHRAC1 n/a
10 TRCN0000017398 GAGCTCTTTGTTCAATGCCTA pLKO.1 326 CDS 100% 2.640 1.848 N CHRAC1 n/a
11 TRCN0000017400 CGGCTCATCTCGCTGCCTCTA pLKO.1 221 CDS 100% 0.000 0.000 N CHRAC1 n/a
12 TRCN0000274395 TTCAGTTTCTTGCAGATATAT pLKO_005 438 CDS 100% 15.000 9.000 N CHRAC1 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1567 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017444.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03405 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03405 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478984 GACAGTTTAACACGACTTTGTTCT pLX_317 100% 100% 100% V5 n/a
Download CSV