Transcript: Human NM_001198780.2

Homo sapiens actin related protein 2/3 complex subunit 4 (ARPC4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARPC4 (10093)
Length:
2113
CDS:
41..604

Additional Resources:

NCBI RefSeq record:
NM_001198780.2
NBCI Gene record:
ARPC4 (10093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380778 GAGCCAGAAGGCGACTTATTT pLKO_005 1003 3UTR 100% 15.000 12.000 N ARPC4 n/a
2 TRCN0000381744 AGATGAAGCTGTCAGTCAATG pLKO_005 540 CDS 100% 10.800 7.560 N ARPC4 n/a
3 TRCN0000382020 GCTGAAGAGTTCCTTAAGAAT pLKO_005 578 CDS 100% 5.625 3.938 N ARPC4 n/a
4 TRCN0000380556 ATCCACTTCATGGAGGAGATT pLKO_005 503 CDS 100% 4.950 3.465 N ARPC4 n/a
5 TRCN0000381623 ACTACCCATGTCTCCACGAAG pLKO_005 640 3UTR 100% 4.050 2.835 N ARPC4 n/a
6 TRCN0000036511 CAAACACAAGTTGGTGGACTT pLKO.1 478 CDS 100% 4.050 2.835 N ARPC4 n/a
7 TRCN0000379862 GCTTTCTGATCACCAACTTCC pLKO_005 441 CDS 100% 4.050 2.835 N ARPC4 n/a
8 TRCN0000036510 GCGAGCAGAGAACTTCTTTAT pLKO.1 385 CDS 100% 13.200 6.600 Y ARPC4 n/a
9 TRCN0000380236 TGCGAGCAGAGAACTTCTTTA pLKO_005 384 CDS 100% 13.200 6.600 Y Arpc4 n/a
10 TRCN0000036509 GCTGATGAGATCGAGAAGATT pLKO.1 332 CDS 100% 5.625 2.813 Y ARPC4 n/a
11 TRCN0000036513 AGTAGCAAAGAGCTCCTGTTA pLKO.1 221 CDS 100% 4.950 2.475 Y ARPC4 n/a
12 TRCN0000036512 CCACAAGTTCATGCGCTTCAT pLKO.1 358 CDS 100% 4.950 2.475 Y ARPC4 n/a
13 TRCN0000382026 GACCATCAGCAGGAATGAGAA pLKO_005 250 CDS 100% 4.950 2.475 Y ARPC4 n/a
14 TRCN0000381624 ACGACACAACAAGCCGGAAGT pLKO_005 190 CDS 100% 4.050 2.025 Y ARPC4 n/a
15 TRCN0000381192 TTGAGGGCTCCATCAACTCTG pLKO_005 285 CDS 100% 4.050 2.025 Y ARPC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02310 pDONR223 100% 89.4% 89.3% None 1_59delinsAT n/a
2 ccsbBroad304_02310 pLX_304 0% 89.4% 89.3% V5 1_59delinsAT n/a
3 TRCN0000473674 CAGACCGGTTTTTCCCAGCATCCC pLX_317 71.7% 89.4% 89.3% V5 1_59delinsAT n/a
Download CSV