Transcript: Human NM_001002264.4

Homo sapiens epithelial stromal interaction 1 (EPSTI1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
EPSTI1 (94240)
Length:
3171
CDS:
77..1309

Additional Resources:

NCBI RefSeq record:
NM_001002264.4
NBCI Gene record:
EPSTI1 (94240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128494 GTTGGAATATGAATAGCGGTA pLKO.1 996 CDS 100% 2.160 3.024 N EPSTI1 n/a
2 TRCN0000428040 CACCTTGATAGCACCAAATAT pLKO_005 277 CDS 100% 15.000 10.500 N EPSTI1 n/a
3 TRCN0000416032 ACTGAACACAGGAGGGTAAAT pLKO_005 911 CDS 100% 13.200 9.240 N EPSTI1 n/a
4 TRCN0000428667 CTCCAGCTGATGCAATCTAAA pLKO_005 449 CDS 100% 13.200 9.240 N EPSTI1 n/a
5 TRCN0000130236 CTGAAGAAGCTGAACTCCAAA pLKO.1 519 CDS 100% 4.950 3.465 N EPSTI1 n/a
6 TRCN0000130015 GAAACTGAAGTCAGACAGAAA pLKO.1 422 CDS 100% 4.950 3.465 N EPSTI1 n/a
7 TRCN0000128242 GAGTGAATTACTGGAACTGAA pLKO.1 850 CDS 100% 4.950 3.465 N EPSTI1 n/a
8 TRCN0000129815 CGGAGAAATGAGATACAAAGA pLKO.1 302 CDS 100% 4.950 2.970 N EPSTI1 n/a
9 TRCN0000131127 GAAGGAGCAGAACAGAGCTAA pLKO.1 358 CDS 100% 4.950 2.970 N EPSTI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04621 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04621 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469999 GGTAGGTATCTCATTCTACCTTTT pLX_317 26.5% 100% 100% V5 n/a
Download CSV