Transcript: Human NM_001251874.2

Homo sapiens KH domain containing 1 (KHDC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
KHDC1 (80759)
Length:
1374
CDS:
446..1159

Additional Resources:

NCBI RefSeq record:
NM_001251874.2
NBCI Gene record:
KHDC1 (80759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165959 GAGAGTTGGTTCACAGCTACA pLKO.1 836 CDS 100% 4.050 2.835 N KHDC1 n/a
2 TRCN0000165108 CAGGACTCCTATCATCATGCT pLKO.1 935 CDS 100% 2.640 1.848 N KHDC1 n/a
3 TRCN0000163914 CCAATGGTGTTTCACATGGAA pLKO.1 731 CDS 100% 3.000 1.800 N KHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12704 pDONR223 100% 68.6% 68.7% None 1_219del;430_432delGTA;435C>T n/a
2 ccsbBroad304_12704 pLX_304 0% 68.6% 68.7% V5 1_219del;430_432delGTA;435C>T n/a
3 TRCN0000470308 CGTTCACCAGGGATGGCGTAGCAC pLX_317 93.9% 68.6% 68.7% V5 1_219del;430_432delGTA;435C>T n/a
Download CSV