Transcript: Human NM_006492.3

Homo sapiens ALX homeobox 3 (ALX3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ALX3 (257)
Length:
1955
CDS:
61..1092

Additional Resources:

NCBI RefSeq record:
NM_006492.3
NBCI Gene record:
ALX3 (257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013540 CAAGAGCAAGAAGCGTCGTAA pLKO.1 507 CDS 100% 4.950 6.930 N ALX3 n/a
2 TRCN0000425444 CGCACGACCTTCAGCACATTC pLKO_005 529 CDS 100% 3.600 2.880 N ALX3 n/a
3 TRCN0000422390 CCCATGCATGTCTCCATATTC pLKO_005 864 CDS 100% 13.200 9.240 N ALX3 n/a
4 TRCN0000013539 CCTTCCTCAGATGGTGACTAT pLKO.1 1000 CDS 100% 4.950 3.465 N ALX3 n/a
5 TRCN0000013542 CCTGGCATCTACTCCATCCAT pLKO.1 943 CDS 100% 3.000 2.100 N ALX3 n/a
6 TRCN0000013538 CCAGACTTTGTCCAAGTCCAT pLKO.1 1375 3UTR 100% 0.264 0.185 N ALX3 n/a
7 TRCN0000013541 GCTGAGGAGAAGACCTCCAAA pLKO.1 337 CDS 100% 4.950 2.970 N ALX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00059 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00059 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476564 CAATGCGGGAATGAAGTTATCGGT pLX_317 30.5% 100% 100% V5 n/a
Download CSV