Transcript: Human NM_001287008.2

Homo sapiens sushi domain containing 3 (SUSD3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SUSD3 (203328)
Length:
1007
CDS:
43..621

Additional Resources:

NCBI RefSeq record:
NM_001287008.2
NBCI Gene record:
SUSD3 (203328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422719 AGTGTTCTGTTCCGGCATATC pLKO_005 809 3UTR 100% 10.800 15.120 N SUSD3 n/a
2 TRCN0000149013 GAAACCACTACTGAGGGTAAT pLKO.1 865 3UTR 100% 10.800 15.120 N SUSD3 n/a
3 TRCN0000433032 TCGAGACTGATGAGTGGAATC pLKO_005 722 3UTR 100% 6.000 8.400 N SUSD3 n/a
4 TRCN0000195778 CAGTCAGCTACAACTCCACAT pLKO.1 681 3UTR 100% 4.050 2.835 N SUSD3 n/a
5 TRCN0000122400 GTGCCACCACACGAGACCTTT pLKO.1 133 CDS 100% 1.650 1.155 N SUSD3 n/a
6 TRCN0000122559 CAAGCACTTCAACAAACCCGT pLKO.1 348 CDS 100% 0.660 0.462 N SUSD3 n/a
7 TRCN0000184382 GCTGAAAGATGAGGACTTGGA pLKO.1 300 CDS 100% 2.640 1.584 N SUSD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05212 pDONR223 100% 75.2% 74.9% None 88_89ins189 n/a
2 TRCN0000470968 GTATACGACCGCTTCAGCCTAATT pLX_317 64.9% 75.2% 74.9% V5 88_89ins189 n/a
Download CSV