Transcript: Human XR_001737526.2

PREDICTED: Homo sapiens TATA-box binding protein associated factor, RNA polymerase I subunit A (TAF1A), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF1A (9015)
Length:
1924
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737526.2
NBCI Gene record:
TAF1A (9015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255938 AGATTGTACCATCTCATAAAT pLKO_005 1139 3UTR 100% 15.000 21.000 N TAF1A n/a
2 TRCN0000013334 CCGGATGCACTAAGAATATAA pLKO.1 1253 3UTR 100% 15.000 21.000 N TAF1A n/a
3 TRCN0000013336 GCTCGGAAGTGAAATTCTATT pLKO.1 485 3UTR 100% 13.200 18.480 N TAF1A n/a
4 TRCN0000013335 CGGGAAATATTAATCAACCTT pLKO.1 696 3UTR 100% 3.000 4.200 N TAF1A n/a
5 TRCN0000255933 CAAGAGGTACTCACCAATTAT pLKO_005 951 3UTR 100% 15.000 12.000 N TAF1A n/a
6 TRCN0000255936 GTAGATATTTCCGGTATATTT pLKO_005 1478 3UTR 100% 15.000 12.000 N TAF1A n/a
7 TRCN0000255939 TATTGGCGTCATGAATTATTT pLKO_005 563 3UTR 100% 15.000 12.000 N TAF1A n/a
8 TRCN0000255934 CTCCTTACAACATGCATTATA pLKO_005 590 3UTR 100% 15.000 10.500 N TAF1A n/a
9 TRCN0000255931 CTGCATCATGGAATGCTTAAA pLKO_005 615 3UTR 100% 13.200 9.240 N TAF1A n/a
10 TRCN0000265714 TAGCTAGAGAAACAATATTAC pLKO_005 1734 3UTR 100% 13.200 9.240 N TAF1A n/a
11 TRCN0000255932 CCTTTGCTCTTTGTAACTATG pLKO_005 1757 3UTR 100% 10.800 7.560 N TAF1A n/a
12 TRCN0000013337 GCCAGGCTTTCATTTCAGCTA pLKO.1 1371 3UTR 100% 2.640 1.848 N TAF1A n/a
13 TRCN0000255937 ATCAAATCCAAATGCCCATAT pLKO_005 992 3UTR 100% 10.800 6.480 N TAF1A n/a
14 TRCN0000013333 GCTTGGTAGATAGTTATTGAA pLKO.1 1632 3UTR 100% 5.625 3.375 N TAF1A n/a
15 TRCN0000255935 TGATAAGTGTGCTTAAGATTT pLKO_005 1060 3UTR 100% 13.200 9.240 N TAF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07338 pDONR223 100% 70.1% None (many diffs) n/a
2 ccsbBroad304_07338 pLX_304 0% 70.1% V5 (many diffs) n/a
Download CSV