Transcript: Human NM_133478.3

Homo sapiens solute carrier family 4 member 5 (SLC4A5), transcript variant c, mRNA.

Source:
NCBI, updated 2019-06-27
Taxon:
Homo sapiens (human)
Gene:
SLC4A5 (57835)
Length:
6357
CDS:
408..3773

Additional Resources:

NCBI RefSeq record:
NM_133478.3
NBCI Gene record:
SLC4A5 (57835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414761 ATCGCAGGAATTGATGAATTT pLKO_005 1566 CDS 100% 13.200 18.480 N SLC4A5 n/a
2 TRCN0000038176 CCCTATCAATATGGACTTCAA pLKO.1 2396 CDS 100% 4.950 6.930 N SLC4A5 n/a
3 TRCN0000038178 CCGGAAGGAGAACAAACTGAA pLKO.1 2981 CDS 100% 4.950 6.930 N SLC4A5 n/a
4 TRCN0000038177 CGACAATTATCAGGGAGTGAT pLKO.1 2048 CDS 100% 4.950 6.930 N SLC4A5 n/a
5 TRCN0000038174 GCCAGCTTTATCATCAAATAT pLKO.1 2280 CDS 100% 15.000 10.500 N SLC4A5 n/a
6 TRCN0000442365 ACCGCTCCTTAGCTGACATTG pLKO_005 1081 CDS 100% 10.800 7.560 N SLC4A5 n/a
7 TRCN0000038175 CCCTCTTTACAGAGATGGATA pLKO.1 742 CDS 100% 4.950 3.465 N SLC4A5 n/a
8 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4515 3UTR 100% 4.950 2.475 Y DENND6A n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4682 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12409 pDONR223 100% 90.9% 90.8% None 80_271del;2316_2429del n/a
2 ccsbBroad304_12409 pLX_304 0% 90.9% 90.8% V5 80_271del;2316_2429del n/a
3 TRCN0000467196 AACCAAGCCCCCATACGACCTATC pLX_317 12.8% 90.9% 90.8% V5 80_271del;2316_2429del n/a
Download CSV