Transcript: Human NM_001366236.1

Homo sapiens phosphoribosyl pyrophosphate synthetase associated protein 1 (PRPSAP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PRPSAP1 (5635)
Length:
1842
CDS:
222..1070

Additional Resources:

NCBI RefSeq record:
NM_001366236.1
NBCI Gene record:
PRPSAP1 (5635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045455 GCTGCAATGTCCCAAGATAAA pLKO.1 950 CDS 100% 13.200 18.480 N PRPSAP1 n/a
2 TRCN0000315729 GCTGCAATGTCCCAAGATAAA pLKO_005 950 CDS 100% 13.200 18.480 N PRPSAP1 n/a
3 TRCN0000045454 GCGCCTATAAGATCTATGTTA pLKO.1 826 CDS 100% 5.625 7.875 N PRPSAP1 n/a
4 TRCN0000045456 AGCAGGTTTAACTCACATTAT pLKO.1 371 CDS 100% 13.200 9.240 N PRPSAP1 n/a
5 TRCN0000315731 AGCAGGTTTAACTCACATTAT pLKO_005 371 CDS 100% 13.200 9.240 N PRPSAP1 n/a
6 TRCN0000079116 CTTCAGTATATCCAGGAAGAA pLKO.1 471 CDS 100% 4.950 3.465 N Prpsap1 n/a
7 TRCN0000045453 CCGATAACTGTAGTTGGAGAT pLKO.1 717 CDS 100% 4.050 2.835 N PRPSAP1 n/a
8 TRCN0000315732 CCGATAACTGTAGTTGGAGAT pLKO_005 717 CDS 100% 4.050 2.835 N PRPSAP1 n/a
9 TRCN0000045457 GCTTTCCTGTGGACAACCTTA pLKO.1 433 CDS 100% 4.950 2.970 N PRPSAP1 n/a
10 TRCN0000315730 GCTTTCCTGTGGACAACCTTA pLKO_005 433 CDS 100% 4.950 2.970 N PRPSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11060 pDONR223 100% 79.1% 79.2% None 0_1ins222;735A>G n/a
2 ccsbBroad304_11060 pLX_304 0% 79.1% 79.2% V5 0_1ins222;735A>G n/a
3 TRCN0000466777 GTCTGTCAGTTTCCAATATTTCTT pLX_317 38.9% 79.1% 79.2% V5 0_1ins222;735A>G n/a
Download CSV