Transcript: Human NM_134268.5

Homo sapiens cytoglobin (CYGB), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CYGB (114757)
Length:
1962
CDS:
168..740

Additional Resources:

NCBI RefSeq record:
NM_134268.5
NBCI Gene record:
CYGB (114757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_134268.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059382 CGGTGTACTTCAAGATCCTCT pLKO.1 529 CDS 100% 2.640 3.696 N CYGB n/a
2 TRCN0000059378 CGCACACATCTACCATATATA pLKO.1 1123 3UTR 100% 15.000 10.500 N CYGB n/a
3 TRCN0000059380 GCCCTCAAGCACAAGGTGGAA pLKO.1 507 CDS 100% 0.880 0.616 N CYGB n/a
4 TRCN0000059379 CCTGGTGAGGTTCTTTGTGAA pLKO.1 302 CDS 100% 4.950 2.970 N CYGB n/a
5 TRCN0000059381 GCAGTACTTCAGCCAGTTCAA pLKO.1 338 CDS 100% 4.950 2.970 N CYGB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134268.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09397 pDONR223 100% 99.8% 99.4% None 110A>G n/a
2 ccsbBroad304_09397 pLX_304 0% 99.8% 99.4% V5 110A>G n/a
3 TRCN0000491965 TAGGTGAGCCTATTTCAATACAAC pLX_317 71% 99.8% 99.4% V5 110A>G n/a
Download CSV