Transcript: Human XM_011510408.3

PREDICTED: Homo sapiens ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 (ASAP2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASAP2 (8853)
Length:
3837
CDS:
86..2965

Additional Resources:

NCBI RefSeq record:
XM_011510408.3
NBCI Gene record:
ASAP2 (8853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379573 GAAATAAGCGGAGCGGAAATT pLKO_005 647 CDS 100% 13.200 18.480 N ASAP2 n/a
2 TRCN0000381484 AGCTACAGATGTGCGAGTATC pLKO_005 702 CDS 100% 10.800 15.120 N ASAP2 n/a
3 TRCN0000331049 GTTGATACAGCTTCGAGATAT pLKO_005 913 CDS 100% 13.200 9.240 N ASAP2 n/a
4 TRCN0000380947 TTCGTCAGAGCACAGCTTATA pLKO_005 987 CDS 100% 13.200 9.240 N ASAP2 n/a
5 TRCN0000093246 CGAGACCCATGAGGACTACAA pLKO.1 121 CDS 100% 4.950 3.465 N 1700030C10Rik n/a
6 TRCN0000029752 CCCTTTGGACAGTTTGCTGAA pLKO.1 493 CDS 100% 4.050 2.835 N ASAP2 n/a
7 TRCN0000029750 CCTGGATAAACAGACAGGGAA pLKO.1 1966 CDS 100% 2.640 1.848 N ASAP2 n/a
8 TRCN0000029749 GCCTCAAACCTTCCATTGAAA pLKO.1 837 CDS 100% 5.625 3.375 N ASAP2 n/a
9 TRCN0000331046 GCCTCAAACCTTCCATTGAAA pLKO_005 837 CDS 100% 5.625 3.375 N ASAP2 n/a
10 TRCN0000243553 GAGACCCATGAGGACTACAAG pLKO_005 122 CDS 100% 4.950 2.970 N Gm9222 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07314 pDONR223 100% 86.1% 80.9% None (many diffs) n/a
2 ccsbBroad304_07314 pLX_304 0% 86.1% 80.9% V5 (many diffs) n/a
3 TRCN0000465586 TGACTTTAATCGCTTTACTTAGAA pLX_317 12.1% 86.1% 80.9% V5 (many diffs) n/a
Download CSV