Transcript: Human NM_014494.4

Homo sapiens trinucleotide repeat containing adaptor 6A (TNRC6A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TNRC6A (27327)
Length:
8491
CDS:
192..6080

Additional Resources:

NCBI RefSeq record:
NM_014494.4
NBCI Gene record:
TNRC6A (27327)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014494.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369459 GATCTGCTGTTAAGGTGTTAA pLKO_005 679 CDS 100% 13.200 18.480 N TNRC6A n/a
2 TRCN0000128817 GAGGCTCTTATGGTACTACAT pLKO.1 1735 CDS 100% 4.950 6.930 N TNRC6A n/a
3 TRCN0000147932 GATGCCTAACAATCAGAGTAT pLKO.1 1391 CDS 100% 4.950 6.930 N TNRC6A n/a
4 TRCN0000150256 GCACTGTAAGTTCTTCATCAA pLKO.1 1228 CDS 100% 4.950 6.930 N TNRC6A n/a
5 TRCN0000129176 CCAGAATCTATACGTCGCAAA pLKO.1 3165 CDS 100% 4.050 5.670 N TNRC6A n/a
6 TRCN0000376423 CTAATGCAGCCTGGCGTAAAT pLKO_005 1839 CDS 100% 13.200 10.560 N TNRC6A n/a
7 TRCN0000254026 CCTTGTCTACGTGGGATAATT pLKO_005 5419 CDS 100% 15.000 10.500 N Tnrc6a n/a
8 TRCN0000364732 CCTTGTCTACGTGGGATAATT pLKO_005 5419 CDS 100% 15.000 10.500 N TNRC6A n/a
9 TRCN0000364712 GAATCATGCAGGCCAATATTA pLKO_005 6238 3UTR 100% 15.000 10.500 N TNRC6A n/a
10 TRCN0000254029 TCATCAAATGGAGGGTTAAAT pLKO_005 1242 CDS 100% 15.000 10.500 N Tnrc6a n/a
11 TRCN0000369457 TTTCCCATGGAGCCATAATAA pLKO_005 1135 CDS 100% 15.000 10.500 N TNRC6A n/a
12 TRCN0000369521 GAAGTGGAAATGGCGCAAATT pLKO_005 1951 CDS 100% 13.200 9.240 N TNRC6A n/a
13 TRCN0000147244 GCAAACATGGTGCTATTTCAA pLKO.1 4855 CDS 100% 5.625 3.938 N TNRC6A n/a
14 TRCN0000127597 CCAGACTGGAACAAGCAACAA pLKO.1 3021 CDS 100% 4.950 3.465 N TNRC6A n/a
15 TRCN0000148284 CCAGTGTCAATGTTTACTCAA pLKO.1 6525 3UTR 100% 4.950 3.465 N TNRC6A n/a
16 TRCN0000130208 CCCAAATCAAAGAGCATGGTT pLKO.1 6997 3UTR 100% 3.000 1.800 N TNRC6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014494.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11864 pDONR223 100% 8.2% 8.2% None 1_5403del n/a
2 ccsbBroad304_11864 pLX_304 0% 8.2% 8.2% V5 1_5403del n/a
Download CSV