Transcript: Human NR_164114.1

Homo sapiens chromosome 10 open reading frame 126 (C10orf126), long non-coding RNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
C10orf126 (283080)
Length:
2149
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164114.1
NBCI Gene record:
C10orf126 (283080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158485 CCAACACAAATTCGTAAACTT pLKO.1 1251 3UTR 100% 5.625 2.813 Y THUMPD3-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13493 pDONR223 100% 4.6% None 1_58del;138A>G;161_2149del n/a
2 ccsbBroad304_13493 pLX_304 0% 4.6% V5 1_58del;138A>G;161_2149del n/a
3 TRCN0000469878 AAATATTTCAAATTACCGGAGTTA pLX_317 100% 4.6% V5 1_58del;138A>G;161_2149del n/a
Download CSV