Transcript: Human NM_012175.4

Homo sapiens F-box protein 3 (FBXO3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FBXO3 (26273)
Length:
2403
CDS:
24..1439

Additional Resources:

NCBI RefSeq record:
NM_012175.4
NBCI Gene record:
FBXO3 (26273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004329 CCTGGGTTCTATGTGACACTA pLKO.1 1565 3UTR 100% 4.950 6.930 N FBXO3 n/a
2 TRCN0000004327 CCCATCATCAGAGACCAAATT pLKO.1 807 CDS 100% 13.200 9.240 N FBXO3 n/a
3 TRCN0000004328 AGGAAGATACATTGACCATTA pLKO.1 281 CDS 100% 10.800 7.560 N FBXO3 n/a
4 TRCN0000004331 CACTGTCTAATCACTATCGTT pLKO.1 514 CDS 100% 3.000 2.100 N FBXO3 n/a
5 TRCN0000004330 CATTCTCTACAACATCAGGAT pLKO.1 1126 CDS 100% 2.640 1.848 N FBXO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02948 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02948 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466992 ACTAGTCCCATTTAAAGACCATTC pLX_317 26.9% 100% 100% V5 n/a
Download CSV