Construct: ORF TRCN0000466992
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017455.1_s317c1
- Derived from:
- ccsbBroadEn_02948
- DNA Barcode:
- ACTAGTCCCATTTAAAGACCATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO3 (26273)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466992
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26273 | FBXO3 | F-box protein 3 | NM_012175.4 | 100% | 100% | |
| 2 | human | 26273 | FBXO3 | F-box protein 3 | NM_033406.3 | 88% | 87.6% | 1241T>A;1243_1244insTGG;1245_1246ins165 |
| 3 | human | 26273 | FBXO3 | F-box protein 3 | XM_011519981.3 | 87.4% | 87.6% | 1237_1241delTTGTT;1245_1246ins173 |
| 4 | human | 26273 | FBXO3 | F-box protein 3 | XM_011519980.2 | 87.1% | 84.7% | (many diffs) |
| 5 | human | 26273 | FBXO3 | F-box protein 3 | XM_017017533.2 | 65.6% | 65.6% | 0_1ins486 |
| 6 | human | 26273 | FBXO3 | F-box protein 3 | XM_011519982.1 | 55% | 52.3% | (many diffs) |
| 7 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_212433.1 | 87.1% | 93.1% | (many diffs) |
| 8 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_001355504.1 | 81.2% | 86.9% | (many diffs) |
| 9 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_020593.2 | 78.4% | 84% | (many diffs) |
| 10 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_001355505.1 | 78% | 84.2% | (many diffs) |
| 11 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_001355506.1 | 72.1% | 77.9% | (many diffs) |
| 12 | mouse | 57443 | Fbxo3 | F-box protein 3 | NM_001355507.1 | 67.5% | 72.8% | (many diffs) |
| 13 | mouse | 57443 | Fbxo3 | F-box protein 3 | NR_149726.1 | 38.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1479
- ORF length:
- 1413
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggccatggag accgagacgg cgccgctgac cctagagtcg ctgcccaccg 121 atcccctgct cctcatctta tcctttttgg actatcggga tctaatcaac tgttgttatg 181 tcagtcgaag acttagccag ctatcaagtc atgatccgct gtggagaaga cattgcaaaa 241 aatactggct gatatctgag gaagagaaaa cacagaagaa tcagtgttgg aaatctctct 301 tcatagatac ttactctgat gtaggaagat acattgacca ttatgctgct attaaaaagg 361 cctgggatga tctcaagaaa tatttggagc ccaggtgtcc tcggatggtt ttatctctga 421 aagagggtgc tcgagaggaa gacctcgatg ctgtggaagc gcagattggc tgcaagcttc 481 ctgacgatta tcgatgttca taccgaattc acaatggaca gaagttagtg gttcctgggt 541 tattgggaag catggcactg tctaatcact atcgttctga agatttgtta gacgtcgata 601 cagctgccgg aggattccag cagagacagg gactgaaata ctgtctccct ttaacttttt 661 gcatacatac tggtttgagt cagtacatag cagtggaagc tgcagagggc cgaaacaaaa 721 atgaagtttt ctaccaatgt ccagaccaaa tggctcgaaa tccagctgct attgacatgt 781 ttattatagg tgctactttt actgactggt ttacctctta tgtcaaaaat gttgtatcag 841 gtggcttccc catcatcaga gaccaaattt tcagatatgt tcacgatcca gaatgtgtag 901 caacaactgg ggatattact gtgtcagttt ccacatcgtt tctgccagaa cttagctctg 961 tacatccacc ccactatttc ttcacatacc gaatcaggat tgaaatgtca aaagatgcac 1021 ttcctgagaa ggcctgtcag ttggacagtc gctattggag aataacaaat gctaagggtg 1081 acgtggaaga agttcaagga cctGGAGTAG TTGGTGAATT TCCAATCATC AGCCCAGGTC 1141 GGGTATATGA ATACACAAGC TGTACCACAT TCTCTACAAC ATCAGGATAC ATGGAAGGAT 1201 ATTATACCTT CCATTTTCTT TACTTTAAAG ACAAGATCTT TAATGTTGCC ATTCCCCGAT 1261 TCCATATGGC ATGTCCAACA TTCAGGGTGT CTATAGCCCG ATTGGAAATG GGTCCTGATG 1321 AATATGAAGA GATGGAAGAA GAGGAGGAGG AGGAAGAGGA GGAAGACGAG GATGATGATT 1381 CAGCAGATAT GGATGAATCA GATGAAGATG ATGAAGAGGA GAGACGGAGG AGAGTCTTTG 1441 ATGTTCCCAT TCGCAGACGC CGCTGCTCAC GCCTTTTTTA CCCAACTTTC TTGTACAAAG 1501 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1561 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1621 ACGAACTAGT CCCATTTAAA GACCATTCAC GCGTTAAGTC gacaatcaac ctctggatta 1681 caaaatttgt gaaagatt