Transcript: Human XR_001740234.2

PREDICTED: Homo sapiens mitochondrial ribosomal protein S25 (MRPS25), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPS25 (64432)
Length:
8420
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740234.2
NBCI Gene record:
MRPS25 (64432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117706 GAAGTACAAAGCCGCTCTGAA pLKO.1 593 3UTR 100% 4.950 6.930 N MRPS25 n/a
2 TRCN0000117703 GCAGATCATGATGTTTAAGAA pLKO.1 296 3UTR 100% 5.625 3.938 N MRPS25 n/a
3 TRCN0000117704 CAAGAGCAATAAGGAGATCAT pLKO.1 386 3UTR 100% 4.950 3.465 N MRPS25 n/a
4 TRCN0000117705 CCAAGAGCAATAAGGAGATCA pLKO.1 385 3UTR 100% 4.950 3.465 N MRPS25 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1611 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03953 pDONR223 100% 6.1% None 1_110del;630_8420del n/a
2 ccsbBroad304_03953 pLX_304 0% 6.1% V5 1_110del;630_8420del n/a
3 TRCN0000465548 GGTCATCTCACATTTCGTTTGACG pLX_317 69% 6.1% V5 1_110del;630_8420del n/a
Download CSV