Transcript: Human XM_024450919.1

PREDICTED: Homo sapiens zinc finger protein 232 (ZNF232), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF232 (7775)
Length:
2473
CDS:
287..802

Additional Resources:

NCBI RefSeq record:
XM_024450919.1
NBCI Gene record:
ZNF232 (7775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021730 CCACTCTACCAGTCAAGAGAT pLKO.1 352 CDS 100% 4.950 6.930 N ZNF232 n/a
2 TRCN0000021733 GATGATGATGATGGGACCAAA pLKO.1 286 5UTR 100% 4.950 2.970 N ZNF232 n/a
3 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2296 3UTR 100% 4.950 2.475 Y ORAI2 n/a
4 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2219 3UTR 100% 4.950 2.475 Y NPHS1 n/a
5 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2293 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11241 pDONR223 100% 34.6% 28.7% None (many diffs) n/a
2 ccsbBroad304_11241 pLX_304 0% 34.6% 28.7% V5 (many diffs) n/a
3 TRCN0000479782 ATACTTCAAAAAGAAATTGAACCG pLX_317 28.7% 34.6% 28.7% V5 (many diffs) n/a
Download CSV