Transcript: Human NM_001291839.2

Homo sapiens IKAROS family zinc finger 1 (IKZF1), transcript variant Ik-4, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
IKZF1 (10320)
Length:
5712
CDS:
66..1238

Additional Resources:

NCBI RefSeq record:
NM_001291839.2
NBCI Gene record:
IKZF1 (10320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107874 CGCCAAACGTAAGAGCTCTAT pLKO.1 491 CDS 100% 4.950 6.930 N IKZF1 n/a
2 TRCN0000236419 CCGCTTCCACATGAGCTAAAG pLKO_005 1220 CDS 100% 10.800 8.640 N IKZF1 n/a
3 TRCN0000107870 GCTATCAATCATTAAGGTCAT pLKO.1 2758 3UTR 100% 4.050 3.240 N IKZF1 n/a
4 TRCN0000236420 GCATTTGGAAACGGGAATAAA pLKO_005 3394 3UTR 100% 15.000 10.500 N IKZF1 n/a
5 TRCN0000236422 CTACGAGAAGGAGAACGAAAT pLKO_005 572 CDS 100% 10.800 7.560 N IKZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11482 pDONR223 100% 81.7% 81.7% None 159_160ins261 n/a
2 ccsbBroad304_11482 pLX_304 0% 81.7% 81.7% V5 159_160ins261 n/a
3 TRCN0000479864 CTGCACAGGTGAAGTGAGACAATT pLX_317 16.8% 81.7% 81.7% V5 159_160ins261 n/a
Download CSV