Transcript: Human NM_001159694.2

Homo sapiens endomucin (EMCN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
EMCN (51705)
Length:
3927
CDS:
109..855

Additional Resources:

NCBI RefSeq record:
NM_001159694.2
NBCI Gene record:
EMCN (51705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372128 TAGGCAATAATTACGCTTAAT pLKO_005 881 3UTR 100% 13.200 18.480 N EMCN n/a
2 TRCN0000128782 CGTGAAGCTTCTTACCGTTAA pLKO.1 780 CDS 100% 10.800 15.120 N EMCN n/a
3 TRCN0000128483 GACTCCATCATTTCAAACGTA pLKO.1 403 CDS 100% 3.000 2.400 N EMCN n/a
4 TRCN0000372129 AGCAACCAGCCGGTCTTATTC pLKO_005 615 CDS 100% 13.200 9.240 N EMCN n/a
5 TRCN0000372127 ATTAACCTCAATACCAGTTAC pLKO_005 528 CDS 100% 10.800 7.560 N EMCN n/a
6 TRCN0000130243 CTCTGATGTCAACAGCTACTT pLKO.1 326 CDS 100% 4.950 3.465 N EMCN n/a
7 TRCN0000131215 GCGTGAAGCTTCTTACCGTTA pLKO.1 779 CDS 100% 4.050 2.835 N EMCN n/a
8 TRCN0000130266 CCACTATGTTAATGCAGGGAA pLKO.1 1299 3UTR 100% 2.640 1.848 N EMCN n/a
9 TRCN0000128183 CAACACCAAACACAGAATCAT pLKO.1 230 CDS 100% 5.625 3.375 N EMCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12009 pDONR223 100% 71.5% 68.5% None (many diffs) n/a
2 ccsbBroad304_12009 pLX_304 0% 71.5% 68.5% V5 (many diffs) n/a
3 TRCN0000472431 AAGAACAACTGCTAGCAGAATCGC pLX_317 65.5% 71.5% 68.5% V5 (many diffs) n/a
Download CSV