Transcript: Human NM_145243.5

Homo sapiens OMA1 zinc metallopeptidase (OMA1), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
OMA1 (115209)
Length:
1861
CDS:
41..1615

Additional Resources:

NCBI RefSeq record:
NM_145243.5
NBCI Gene record:
OMA1 (115209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145243.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062119 CCGATATTCATCAACTTTCTT pLKO.1 987 CDS 100% 5.625 7.875 N OMA1 n/a
2 TRCN0000062120 GCCAGTGGATACAGTCTAAAT pLKO.1 1152 CDS 100% 13.200 10.560 N OMA1 n/a
3 TRCN0000417264 ACAGGAGCAAATACCATTAAC pLKO_005 1564 CDS 100% 13.200 9.240 N OMA1 n/a
4 TRCN0000432746 TCCAGACCCTCGATTACTATT pLKO_005 1450 CDS 100% 13.200 9.240 N OMA1 n/a
5 TRCN0000425756 AGAAGTTATTTGCAATCATTG pLKO_005 513 CDS 100% 10.800 7.560 N OMA1 n/a
6 TRCN0000428754 CAAGATGCCAGAATGGTTATC pLKO_005 1330 CDS 100% 10.800 7.560 N OMA1 n/a
7 TRCN0000062121 GCTGTCATCAAGTACAAGTTA pLKO.1 150 CDS 100% 5.625 3.938 N OMA1 n/a
8 TRCN0000062118 TGAAGAATGTTGCAGTCCTTA pLKO.1 1643 3UTR 100% 4.950 3.465 N OMA1 n/a
9 TRCN0000062122 CCTCACAATGATTTGGGCCAT pLKO.1 1102 CDS 100% 2.160 1.512 N OMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145243.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09414 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09414 pLX_304 0% 100% 100% V5 n/a
Download CSV