Transcript: Human XM_017019483.2

PREDICTED: Homo sapiens pro-melanin concentrating hormone (PMCH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMCH (5367)
Length:
2729
CDS:
1771..2226

Additional Resources:

NCBI RefSeq record:
XM_017019483.2
NBCI Gene record:
PMCH (5367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150973 CACAGGCTCCAAACATAATTT pLKO.1 2022 CDS 100% 15.000 21.000 N PMCH n/a
2 TRCN0000151370 GTTTCATGAACGAAGAGGAAA pLKO.1 1985 CDS 100% 4.950 3.960 N PMCH n/a
3 TRCN0000150397 CCTTCCCTGGAACAATATAAA pLKO.1 1951 CDS 100% 15.000 10.500 N PMCH n/a
4 TRCN0000150859 GCATCCAAGTCCATAAGAAAT pLKO.1 1846 CDS 100% 13.200 9.240 N PMCH n/a
5 TRCN0000153794 CTTTCAGCATCCAAGTCCATA pLKO.1 1840 CDS 100% 4.950 3.465 N PMCH n/a
6 TRCN0000153170 GAAAGGCTTTCAGAAGGAAGA pLKO.1 1905 CDS 100% 4.050 2.835 N PMCH n/a
7 TRCN0000151408 GAATGGAGTTCAGAATACTGA pLKO.1 2121 CDS 100% 3.000 2.100 N PMCH n/a
8 TRCN0000152651 GAGAGCAGTTTCATGAACGAA pLKO.1 1978 CDS 100% 3.000 2.100 N PMCH n/a
9 TRCN0000155140 GTTATTGCTCCTTCCCTGGAA pLKO.1 1942 CDS 100% 2.640 1.848 N PMCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01225 pDONR223 100% 91.1% 90.3% None 449delG;451_452insCTC;453_454ins40 n/a
2 ccsbBroad304_01225 pLX_304 0% 91.1% 90.3% V5 449delG;451_452insCTC;453_454ins40 n/a
3 TRCN0000468396 CGGCATTCCGTCAATTGCCGAACT pLX_317 60.9% 91.1% 90.3% V5 449delG;451_452insCTC;453_454ins40 n/a
Download CSV