Transcript: Human NM_001130047.2

Homo sapiens tubulin folding cofactor E like (TBCEL), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-02
Taxon:
Homo sapiens (human)
Gene:
TBCEL (219899)
Length:
5067
CDS:
101..1375

Additional Resources:

NCBI RefSeq record:
NM_001130047.2
NBCI Gene record:
TBCEL (219899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146463 CACTTTAACGATCAGGTGGAA pLKO.1 1145 CDS 100% 2.640 3.696 N TBCEL n/a
2 TRCN0000421310 GAGCGAAGGAAATTGGTAATA pLKO_005 914 CDS 100% 13.200 10.560 N TBCEL n/a
3 TRCN0000146654 CAGTGTCTTGTCCTTCTATTT pLKO.1 594 CDS 100% 13.200 9.240 N TBCEL n/a
4 TRCN0000146770 CGAGAAGATTCTGAGAGATTT pLKO.1 989 CDS 100% 13.200 9.240 N TBCEL n/a
5 TRCN0000148247 GCCATCAGTTTCCAAACTTAA pLKO.1 943 CDS 100% 13.200 9.240 N TBCEL n/a
6 TRCN0000425441 ATACGAAAGTTAGGAGTTATG pLKO_005 674 CDS 100% 10.800 7.560 N TBCEL n/a
7 TRCN0000149782 GAAGTGCCATTCAGGTATCAT pLKO.1 1043 CDS 100% 5.625 3.938 N TBCEL n/a
8 TRCN0000149362 GCATTGCATTCCTTTGGCATT pLKO.1 1313 CDS 100% 4.050 2.430 N TBCEL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05234 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05234 pLX_304 0% 100% 100% V5 (not translated due to frame shift) n/a
3 TRCN0000468699 GACGATCCAATCGCGACGTGTACT pLX_317 38.1% 100% 100% V5 (not translated due to frame shift) n/a
Download CSV