Transcript: Human NM_173477.5

Homo sapiens USH1 protein network component sans (USH1G), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
USH1G (124590)
Length:
3558
CDS:
183..1568

Additional Resources:

NCBI RefSeq record:
NM_173477.5
NBCI Gene record:
USH1G (124590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118963 CCATGGTGTTCCGCAGAAATT pLKO.1 1123 CDS 100% 13.200 18.480 N USH1G n/a
2 TRCN0000420676 TGGAGGACACAGAGCTATAAC pLKO_005 1549 CDS 100% 13.200 18.480 N USH1G n/a
3 TRCN0000118965 CCCTGGGATGAGCTCGATTTA pLKO.1 1299 CDS 100% 13.200 9.240 N USH1G n/a
4 TRCN0000438092 TGGTGCCTAGACAACGACTAC pLKO_005 456 CDS 100% 4.050 2.835 N USH1G n/a
5 TRCN0000118962 CCTGCATTGTTGTGAAGGGAA pLKO.1 2004 3UTR 100% 2.640 1.848 N USH1G n/a
6 TRCN0000118966 GCCACCCGAAAGGAGCTGAAT pLKO.1 240 CDS 100% 1.650 1.155 N USH1G n/a
7 TRCN0000118964 CCACATGGAATGCGTGCGCTA pLKO.1 509 CDS 100% 0.720 0.504 N USH1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04787 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04787 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465942 TGCTTACAGAATAAAATTAACGGA pLX_317 17% 100% 100% V5 n/a
Download CSV