Transcript: Human NM_001257160.2

Homo sapiens centrosomal protein 41 (CEP41), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CEP41 (95681)
Length:
3121
CDS:
51..215

Additional Resources:

NCBI RefSeq record:
NM_001257160.2
NBCI Gene record:
CEP41 (95681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145058 CCAAGATACCAGCATATCAAA pLKO.1 111 CDS 100% 5.625 7.875 N CEP41 n/a
2 TRCN0000073773 CCTCTCAAGTAGCTGGGACTA pLKO.1 1927 3UTR 100% 4.050 2.025 Y TINAGL1 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1621 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 1585 3UTR 100% 4.950 2.475 Y RBM48 n/a
5 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1932 3UTR 100% 2.640 1.320 Y LINC01098 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1621 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13007 pDONR223 100% 16.2% 10.7% None (many diffs) n/a
2 ccsbBroad304_13007 pLX_304 0% 16.2% 10.7% V5 (many diffs) n/a
3 TRCN0000480131 CCTTCTGCGCGAGTCCACAGGTCC pLX_317 42.5% 16.2% 10.7% V5 (many diffs) n/a
Download CSV