Construct: ORF TRCN0000480131
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006842.1_s317c1
- Derived from:
- ccsbBroadEn_13007
- DNA Barcode:
- CCTTCTGCGCGAGTCCACAGGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEP41 (95681)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480131
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 95681 | CEP41 | centrosomal protein 41 | NM_001257158.2 | 100% | 100% | |
| 2 | human | 95681 | CEP41 | centrosomal protein 41 | NM_001257159.1 | 94.6% | 94.3% | 97_98ins48 |
| 3 | human | 95681 | CEP41 | centrosomal protein 41 | NM_018718.3 | 80.6% | 80.6% | 758_973del |
| 4 | human | 95681 | CEP41 | centrosomal protein 41 | XM_024447004.1 | 77.2% | 77.2% | 0_1ins39;719_934del |
| 5 | human | 95681 | CEP41 | centrosomal protein 41 | XM_011516709.3 | 71.3% | 71.3% | 0_1ins105;653_868del |
| 6 | human | 95681 | CEP41 | centrosomal protein 41 | XM_011516710.3 | 71.3% | 71.3% | 0_1ins105;653_868del |
| 7 | human | 95681 | CEP41 | centrosomal protein 41 | NM_001257160.2 | 16.2% | 10.7% | (many diffs) |
| 8 | human | 95681 | CEP41 | centrosomal protein 41 | NR_046443.2 | 13.1% | (many diffs) | |
| 9 | mouse | 83922 | Cep41 | centrosomal protein 41 | NM_031998.3 | 68.8% | 70.5% | (many diffs) |
| 10 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_006505207.3 | 67.8% | 67.3% | (many diffs) |
| 11 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_011241090.1 | 67.6% | 68.6% | (many diffs) |
| 12 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_006505208.3 | 67.2% | 67.8% | (many diffs) |
| 13 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_006505211.3 | 65.1% | 66.2% | (many diffs) |
| 14 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_006505210.3 | 64.1% | 63.1% | (many diffs) |
| 15 | mouse | 83922 | Cep41 | centrosomal protein 41 | XM_006505213.3 | 58.6% | 57.9% | (many diffs) |
| 16 | mouse | 83922 | Cep41 | centrosomal protein 41 | NR_130781.1 | 21.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 972
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccctccgg aggcacattg ggaaccctga gtatctgatg aaaaggatac 121 cacagaaccc aagataccag catatcaaat caagactgga cactggtaac agtatgacta 181 aatatactga gaagctcgaa gagattaaga aaaattatag atacaaaaaa gatgagcttt 241 tcaagagact aaaagttaca acttttgccc agctgatcat ccaagttgct tccctctctg 301 atcaaacact ggaagtgaca gctgaggaga ttcaaaggct ggaagacaat gattctgcag 361 cttcagaccc tgatgctgaa accactgcca ggaccaatgg gaaaggaaat ccaggtgagc 421 agtcgccgag ccctgagcag ttcataaaca acgcaggagc aggggactcc agccgctcaa 481 ctcttcagag tgtcatcagt ggtgttgggg aactggatct agacaaaggg ccagtgaaga 541 aagcagagcc ccataccaaa gacaaacctt atcctgactg ccccttccTG CTGCTAGATG 601 TGCGTGATAG AGATTCTTAC CAGCAGTGCC ACATTGTTGG AGCTTACAGT TACCCAATTG 661 CAACTCTGTC TAGAACAATG AACCCTTATT CAAATGATAT TCTTGAATAT AAAAATGCCC 721 ATGGCAAGAT CATCATTCTG TATGACGATG ATGAAAGGCT GGCCAGTCAG GCGGCCACCA 781 CCATGTGCGA GCGTGGATTT GAAAACCTCT TCATGCTTTC CGGAGGCCGA CTGAACCAAG 841 CTAACTCCTC CGGAAGAGAG TCCAAGGTGC CTGGTGCCCG AAGCGCTCAG AATCTGCCAG 901 GTGGCGGCCC CGCCAGCCAC TCAAACCCCC GCTCCCTCAG CAGTGGTCAC CTGCAAGGCA 961 AACCCTGGAA GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCT TCTGCGCGAG TCCACAGGTC 1141 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t