Transcript: Human NM_003270.4

Homo sapiens tetraspanin 6 (TSPAN6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TSPAN6 (7105)
Length:
3768
CDS:
113..850

Additional Resources:

NCBI RefSeq record:
NM_003270.4
NBCI Gene record:
TSPAN6 (7105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003270.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381476 GTTGTGGTGTCACCGATTATA pLKO_005 570 CDS 100% 15.000 21.000 N TSPAN6 n/a
2 TRCN0000379463 GTCGCTGCCATCGTAGGATTT pLKO_005 428 CDS 100% 10.800 15.120 N TSPAN6 n/a
3 TRCN0000380267 TCGCAGTGGGCTGATTCAATC pLKO_005 1050 3UTR 100% 10.800 15.120 N TSPAN6 n/a
4 TRCN0000153653 CAAGAGCGTTCTGCTAATCTA pLKO.1 163 CDS 100% 5.625 7.875 N TSPAN6 n/a
5 TRCN0000152067 CCTAAGAGTTGCTGTAAACTT pLKO.1 632 CDS 100% 5.625 7.875 N TSPAN6 n/a
6 TRCN0000312422 CCTAAGAGTTGCTGTAAACTT pLKO_005 632 CDS 100% 5.625 7.875 N TSPAN6 n/a
7 TRCN0000152829 GCTACTGGTACCGTCATTATT pLKO.1 308 CDS 100% 0.000 0.000 N TSPAN6 n/a
8 TRCN0000379532 AGATTGGACAGATACTAATTA pLKO_005 592 CDS 100% 15.000 12.000 N TSPAN6 n/a
9 TRCN0000153171 GCAATGTTTCTGACTCTCGTT pLKO.1 392 CDS 100% 2.640 2.112 N TSPAN6 n/a
10 TRCN0000312473 GCAATGTTTCTGACTCTCGTT pLKO_005 392 CDS 100% 2.640 2.112 N TSPAN6 n/a
11 TRCN0000379955 ATAAAGGTGATGACCATTATA pLKO_005 707 CDS 100% 15.000 10.500 N TSPAN6 n/a
12 TRCN0000150937 GAAGGCTTTGAAGCAGTATAA pLKO.1 493 CDS 100% 13.200 9.240 N TSPAN6 n/a
13 TRCN0000349721 GAAGGCTTTGAAGCAGTATAA pLKO_005 493 CDS 100% 13.200 9.240 N TSPAN6 n/a
14 TRCN0000150368 CCAACTGATTGGAATCTTTCT pLKO.1 778 CDS 100% 4.950 3.465 N TSPAN6 n/a
15 TRCN0000157444 GCTGGAGAACTGACAACACTA pLKO.1 929 3UTR 100% 4.950 3.465 N TSPAN6 n/a
16 TRCN0000312475 GCTGGAGAACTGACAACACTA pLKO_005 929 3UTR 100% 4.950 3.465 N TSPAN6 n/a
17 TRCN0000152291 CAGTATAACTCTACAGGAGAT pLKO.1 506 CDS 100% 4.050 2.835 N TSPAN6 n/a
18 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 2850 3UTR 100% 10.800 5.400 Y SMIM11A n/a
19 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 2952 3UTR 100% 5.625 2.813 Y NLRP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003270.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07078 pDONR223 100% 99.8% 100% None 381G>A n/a
2 ccsbBroad304_07078 pLX_304 0% 99.8% 100% V5 381G>A n/a
3 TRCN0000473913 AACTCCTTGGCACCGGACACGGCA pLX_317 65.1% 99.8% 100% V5 381G>A n/a
Download CSV