Transcript: Human XM_024453327.1

PREDICTED: Homo sapiens follistatin like 1 (FSTL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FSTL1 (11167)
Length:
4924
CDS:
1555..2250

Additional Resources:

NCBI RefSeq record:
XM_024453327.1
NBCI Gene record:
FSTL1 (11167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053983 GCCATCAATATTACAACGTAT pLKO.1 1855 CDS 100% 4.950 3.960 N FSTL1 n/a
2 TRCN0000300578 GCCATCAATATTACAACGTAT pLKO_005 1855 CDS 100% 4.950 3.960 N FSTL1 n/a
3 TRCN0000331350 AGGCCTGTGTGTGGCAGTAAT pLKO_005 221 5UTR 100% 13.200 9.240 N FSTL1 n/a
4 TRCN0000331284 GTCGCCAAATCACCAGTATTT pLKO_005 2333 3UTR 100% 13.200 9.240 N FSTL1 n/a
5 TRCN0000053985 CCTGAAGTTTGTGGAACAGAA pLKO.1 1827 CDS 100% 4.950 3.465 N FSTL1 n/a
6 TRCN0000053984 GCTAAGGAGCAAATCCAAGAT pLKO.1 103 5UTR 100% 4.950 3.465 N FSTL1 n/a
7 TRCN0000310639 GCTAAGGAGCAAATCCAAGAT pLKO_005 103 5UTR 100% 4.950 3.465 N FSTL1 n/a
8 TRCN0000053987 CCAGGTTGATTACGATGGACA pLKO.1 304 5UTR 100% 2.640 1.848 N FSTL1 n/a
9 TRCN0000300601 CCAGGTTGATTACGATGGACA pLKO_005 304 5UTR 100% 2.640 1.848 N FSTL1 n/a
10 TRCN0000012005 CTCTGCATTGAGCAATGCAAA pLKO.1 191 5UTR 100% 0.495 0.347 N Fstl1 n/a
11 TRCN0000053986 GATTGGAAACTCAGCTTCCAA pLKO.1 1951 CDS 100% 0.300 0.210 N FSTL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02639 pDONR223 100% 71.9% 63% None (many diffs) n/a
2 ccsbBroad304_02639 pLX_304 0% 71.9% 63% V5 (many diffs) n/a
3 TRCN0000474964 GATGAGCTTCCTTTAGACCCCTGA pLX_317 45.5% 71.9% 63% V5 (many diffs) n/a
Download CSV