Transcript: Human NM_005099.6

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 4 (ADAMTS4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ADAMTS4 (9507)
Length:
9777
CDS:
428..2941

Additional Resources:

NCBI RefSeq record:
NM_005099.6
NBCI Gene record:
ADAMTS4 (9507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005099.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377640 AGGCACTGGGCTACTACTATG pLKO_005 2304 CDS 100% 10.800 8.640 N ADAMTS4 n/a
2 TRCN0000377639 TGTTAGGCGTGTTACAATATC pLKO_005 873 CDS 100% 13.200 9.240 N ADAMTS4 n/a
3 TRCN0000062261 AGATGACAAGATGGCCGCATT pLKO.1 1105 CDS 100% 4.050 2.835 N ADAMTS4 n/a
4 TRCN0000062258 CAGGAAATTCAGGTACGGATA pLKO.1 2503 CDS 100% 4.050 2.835 N ADAMTS4 n/a
5 TRCN0000062259 CATCAGTTTGAATGGGCCTTT pLKO.1 1558 CDS 100% 4.050 2.835 N ADAMTS4 n/a
6 TRCN0000062262 CGTGTTTCCAGAGAAGCTCAA pLKO.1 610 CDS 100% 4.050 2.835 N ADAMTS4 n/a
7 TRCN0000032006 GACCACTTTGACACAGCCATT pLKO.1 1349 CDS 100% 4.050 2.835 N Adamts4 n/a
8 TRCN0000062260 CCTTTGACACTGCAAGTCCTA pLKO.1 2765 CDS 100% 2.640 1.848 N ADAMTS4 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4038 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5057 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3966 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 9133 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3966 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005099.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11377 pDONR223 100% 39.8% 39.1% None (many diffs) n/a
2 ccsbBroad304_11377 pLX_304 0% 39.8% 39.1% V5 (many diffs) n/a
3 TRCN0000474754 AGAGATTATCGATATAAAGGTTCC pLX_317 41.6% 39.8% 39.1% V5 (many diffs) n/a
Download CSV