Transcript: Human NM_001318737.3

Homo sapiens coiled-coil domain containing 82 (CCDC82), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CCDC82 (79780)
Length:
3932
CDS:
208..1242

Additional Resources:

NCBI RefSeq record:
NM_001318737.3
NBCI Gene record:
CCDC82 (79780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430766 ACGCAGTAGTGGTAGAGATTT pLKO_005 969 CDS 100% 13.200 18.480 N CCDC82 n/a
2 TRCN0000435881 GTTGATTGGAGGCGAACTAAA pLKO_005 277 CDS 100% 13.200 18.480 N CCDC82 n/a
3 TRCN0000128463 GAAGAGCTTGATAGTGAAGAA pLKO.1 331 CDS 100% 4.950 3.465 N CCDC82 n/a
4 TRCN0000129929 GATGAAGAGCTTGATAGTGAT pLKO.1 361 CDS 100% 4.950 3.465 N CCDC82 n/a
5 TRCN0000412553 GTGAAAGAGAGCTCAACTTAA pLKO_005 449 CDS 100% 13.200 7.920 N CCDC82 n/a
6 TRCN0000130856 GATAGTAACAAGGGACCTGAT pLKO.1 409 CDS 100% 4.050 2.430 N CCDC82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12616 pDONR223 100% 99.9% 99.7% None 445C>G n/a
2 ccsbBroad304_12616 pLX_304 0% 99.9% 99.7% V5 445C>G n/a
3 TRCN0000472780 CCTAACGTGGAAGGAAAGCCTGCG pLX_317 52.3% 99.9% 99.7% V5 445C>G n/a
Download CSV