Transcript: Human XM_011521325.3

PREDICTED: Homo sapiens family with sequence similarity 227 member B (FAM227B), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM227B (196951)
Length:
1578
CDS:
372..1388

Additional Resources:

NCBI RefSeq record:
XM_011521325.3
NBCI Gene record:
FAM227B (196951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135434 GCAACGTTCCATGAAGCATTT pLKO.1 1152 CDS 100% 10.800 15.120 N FAM227B n/a
2 TRCN0000135316 CCTCCAAAGAGCATTGAAGAA pLKO.1 435 CDS 100% 4.950 3.465 N FAM227B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13373 pDONR223 100% 89.8% 89.6% None 645_746del;1013T>G n/a
2 ccsbBroad304_13373 pLX_304 0% 89.8% 89.6% V5 645_746del;1013T>G n/a
3 TRCN0000491924 GCCGTAAATTATTGTTAGGCCGCT pLX_317 38.7% 89.8% 89.6% V5 645_746del;1013T>G n/a
Download CSV