Transcript: Human XM_006720427.4

PREDICTED: Homo sapiens family with sequence similarity 227 member B (FAM227B), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM227B (196951)
Length:
2029
CDS:
502..1854

Additional Resources:

NCBI RefSeq record:
XM_006720427.4
NBCI Gene record:
FAM227B (196951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135434 GCAACGTTCCATGAAGCATTT pLKO.1 1033 CDS 100% 10.800 15.120 N FAM227B n/a
2 TRCN0000133885 CCATATCCAAGGAAGAATCAA pLKO.1 1319 CDS 100% 5.625 7.875 N FAM227B n/a
3 TRCN0000136450 CTACATAAACTGCGTTCCGAA pLKO.1 1735 CDS 100% 2.640 3.696 N FAM227B n/a
4 TRCN0000419602 AGTACTGGTCCAGAGTTTAAT pLKO_005 1375 CDS 100% 15.000 10.500 N FAM227B n/a
5 TRCN0000136127 GAGCATATACGTTGCCCATAT pLKO.1 1304 CDS 100% 10.800 7.560 N FAM227B n/a
6 TRCN0000135316 CCTCCAAAGAGCATTGAAGAA pLKO.1 253 5UTR 100% 4.950 3.465 N FAM227B n/a
7 TRCN0000136232 GCTACCAAGAAACCTCATGAA pLKO.1 1690 CDS 100% 4.950 3.465 N FAM227B n/a
8 TRCN0000420331 GAGGTCAGAGTCCATTGATTT pLKO_005 1415 CDS 100% 13.200 7.920 N FAM227B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13373 pDONR223 100% 41.4% 41.4% None 0_1ins249;396_497del;765_1350delinsC n/a
2 ccsbBroad304_13373 pLX_304 0% 41.4% 41.4% V5 0_1ins249;396_497del;765_1350delinsC n/a
3 TRCN0000491924 GCCGTAAATTATTGTTAGGCCGCT pLX_317 38.7% 41.4% 41.4% V5 0_1ins249;396_497del;765_1350delinsC n/a
Download CSV