Transcript: Human NM_153378.3

Homo sapiens solute carrier family 22 member 12 (SLC22A12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC22A12 (116085)
Length:
2526
CDS:
735..1733

Additional Resources:

NCBI RefSeq record:
NM_153378.3
NBCI Gene record:
SLC22A12 (116085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043461 CCGGACCTGTATCTCCACGTT pLKO.1 1115 CDS 100% 0.880 1.232 N SLC22A12 n/a
2 TRCN0000444832 CATCTACCTGGCTGGGATTCT pLKO_005 676 5UTR 100% 4.950 3.465 N SLC22A12 n/a
3 TRCN0000043459 GCAACATCTTCCTGCTCCAAA pLKO.1 1198 CDS 100% 4.950 3.465 N SLC22A12 n/a
4 TRCN0000043458 GCAGTAAAGAAGGCAACACAT pLKO.1 1671 CDS 100% 4.950 3.465 N SLC22A12 n/a
5 TRCN0000438404 ACAATCGTGGCCAAGTGGAAC pLKO_005 614 5UTR 100% 4.050 2.835 N SLC22A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09428 pDONR223 100% 59.9% 60% None 0_1ins663;585A>G n/a
2 ccsbBroad304_09428 pLX_304 0% 59.9% 60% V5 0_1ins663;585A>G n/a
3 TRCN0000478361 CATAGGGGTGGCGCTCTGAATCCC pLX_317 18.3% 59.9% 60% V5 0_1ins663;585A>G n/a
Download CSV