Transcript: Human XR_922903.2

PREDICTED: Homo sapiens 3-hydroxyisobutyryl-CoA hydrolase (HIBCH), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIBCH (26275)
Length:
1376
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922903.2
NBCI Gene record:
HIBCH (26275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078607 CCTAGAGCAATTGAAGGTAAT pLKO.1 939 3UTR 100% 10.800 8.640 N HIBCH n/a
2 TRCN0000229744 TGATGTGGGTGGAGGTTATTT pLKO_005 591 3UTR 100% 15.000 10.500 N HIBCH n/a
3 TRCN0000251113 TGATGTGGGTGGAGGTTATTT pLKO_005 591 3UTR 100% 15.000 10.500 N Hibch n/a
4 TRCN0000229742 TAATATGATTCGGCAGATTTA pLKO_005 249 3UTR 100% 13.200 9.240 N HIBCH n/a
5 TRCN0000229743 TGAAACTTTCCTGATCATTAT pLKO_005 300 3UTR 100% 13.200 9.240 N HIBCH n/a
6 TRCN0000078606 CTTAATATGATTCGGCAGATT pLKO.1 247 3UTR 100% 4.950 3.465 N HIBCH n/a
7 TRCN0000078605 CCACAGCTAAAGAAGTGGGAA pLKO.1 271 3UTR 100% 2.640 1.848 N HIBCH n/a
8 TRCN0000078604 GCACCATTTGAGAATGTCCAA pLKO.1 132 3UTR 100% 2.640 1.848 N HIBCH n/a
9 TRCN0000229745 ATGGAAACCAGCTGATCTAAA pLKO_005 1103 3UTR 100% 13.200 7.920 N HIBCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11824 pDONR223 100% 72.5% None 1_78del;199A>G;1078_1376del n/a
2 ccsbBroad304_11824 pLX_304 0% 72.5% V5 1_78del;199A>G;1078_1376del n/a
3 TRCN0000469384 GCCAACAGCCATTGATCTCCGGAA pLX_317 35.3% 72.5% V5 1_78del;199A>G;1078_1376del n/a
Download CSV