Transcript: Human XM_017029468.2

PREDICTED: Homo sapiens SH3 domain containing kinase binding protein 1 (SH3KBP1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3KBP1 (30011)
Length:
4548
CDS:
363..2108

Additional Resources:

NCBI RefSeq record:
XM_017029468.2
NBCI Gene record:
SH3KBP1 (30011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418974 TGAAAGTTGGCGACATCATAG pLKO_005 595 CDS 100% 10.800 15.120 N SH3KBP1 n/a
2 TRCN0000038021 GCAGCTATCCAAGTCAAGTTT pLKO.1 743 CDS 100% 5.625 7.313 N SH3KBP1 n/a
3 TRCN0000038019 CACAACACAAATTCCATCCAA pLKO.1 2254 3UTR 100% 3.000 2.400 N SH3KBP1 n/a
4 TRCN0000417097 GACGATCAGCGTGGGTGAAAT pLKO_005 319 5UTR 100% 13.200 9.240 N SH3KBP1 n/a
5 TRCN0000423295 AGTTACTTCCACCGGACTTTG pLKO_005 1210 CDS 100% 10.800 7.560 N SH3KBP1 n/a
6 TRCN0000038022 CCAGCAGAAACGAGAGATTAA pLKO.1 1994 CDS 100% 13.200 7.920 N SH3KBP1 n/a
7 TRCN0000038023 GCAGGACAAAGAGCAAGGATT pLKO.1 1030 CDS 100% 4.950 2.970 N SH3KBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08160 pDONR223 100% 87.3% 85.8% None (many diffs) n/a
2 ccsbBroad304_08160 pLX_304 0% 87.3% 85.8% V5 (many diffs) n/a
3 TRCN0000475526 GGACACTCCTACTCCAAGGCTAAA pLX_317 7% 87.3% 85.8% V5 (many diffs) n/a
Download CSV