Transcript: Human NM_001321375.2

Homo sapiens zinc finger protein 671 (ZNF671), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF671 (79891)
Length:
2304
CDS:
264..1574

Additional Resources:

NCBI RefSeq record:
NM_001321375.2
NBCI Gene record:
ZNF671 (79891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218897 GCAGTAAGTCTAATCTCATTC pLKO_005 1105 CDS 100% 10.800 15.120 N ZNF671 n/a
2 TRCN0000231088 TACCTTACACCTGGCTAAATA pLKO_005 494 CDS 100% 0.000 0.000 N ZNF671 n/a
3 TRCN0000231090 CATACTGCGTTTACCATTTAC pLKO_005 1982 3UTR 100% 13.200 10.560 N ZNF671 n/a
4 TRCN0000019516 GCAGTGATTATGAGTGTAGCA pLKO.1 1312 CDS 100% 2.640 2.112 N ZNF671 n/a
5 TRCN0000019514 GCCAAAGCTATGACCTCTTTA pLKO.1 937 CDS 100% 13.200 9.240 N ZNF671 n/a
6 TRCN0000231089 ACACGGGTGAAAGACTCTATC pLKO_005 1057 CDS 100% 10.800 7.560 N ZNF671 n/a
7 TRCN0000231087 GATCACGTGCAGTCATGAAAC pLKO_005 250 5UTR 100% 10.800 7.560 N ZNF671 n/a
8 TRCN0000019517 GCTTGTGAGTGGCTTTCTCAT pLKO.1 788 CDS 100% 4.950 3.465 N ZNF671 n/a
9 TRCN0000019515 CCCAATATTGAAAGATACCTT pLKO.1 479 CDS 100% 3.000 2.100 N ZNF671 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14274 pDONR223 100% 78.4% 78.4% None 0_1ins294;1308_1309ins66 n/a
2 ccsbBroad304_14274 pLX_304 0% 78.4% 78.4% V5 0_1ins294;1308_1309ins66 n/a
3 TRCN0000468184 AATTTTAGCAAGCCTGGTGATATC pLX_317 10.3% 78.4% 78.4% V5 0_1ins294;1308_1309ins66 n/a
Download CSV