Transcript: Human NM_001293696.2

Homo sapiens septin 9 (SEPTIN9), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SEPTIN9 (10801)
Length:
3039
CDS:
16..1104

Additional Resources:

NCBI RefSeq record:
NM_001293696.2
NBCI Gene record:
SEPTIN9 (10801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119070 CAAGTCCATCACGCACGATAT pLKO.1 369 CDS 100% 10.800 15.120 N SEPTIN9 n/a
2 TRCN0000440381 TTCGACATGCTGCCAGGAAAC pLKO_005 1224 3UTR 100% 6.000 8.400 N SEPTIN9 n/a
3 TRCN0000119069 CCTGGACATCGAGTTTATGAA pLKO.1 615 CDS 100% 5.625 7.875 N SEPTIN9 n/a
4 TRCN0000119071 CACGCACGATATTGAGGAGAA pLKO.1 378 CDS 100% 4.050 5.670 N SEPTIN9 n/a
5 TRCN0000119068 GCTTGGGTAAATCCACCTTAA pLKO.1 266 CDS 100% 10.800 8.640 N SEPTIN9 n/a
6 TRCN0000119067 CCTTCTCTGTAACCAGACTTT pLKO.1 2880 3UTR 100% 4.950 3.465 N SEPTIN9 n/a
7 TRCN0000445092 TCAACGGCAAGAGGATCCTTG pLKO_005 866 CDS 100% 4.050 2.835 N SEPTIN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07685 pDONR223 100% 62.4% 60.2% None (many diffs) n/a
2 ccsbBroad304_07685 pLX_304 0% 62.4% 60.2% V5 (many diffs) n/a
3 TRCN0000466954 CGCCCAAGTATTAATTACCCAGTC pLX_317 21.8% 62.4% 60.2% V5 (many diffs) n/a
Download CSV